PCR, Southern blotting and oocyte expression to assess the efficacy of subtractive hybridization.
نویسندگان
چکیده
Subtractive hybridization is a technique designed to isolate genes and transcripts abundant in or unique to a particular condition. The method has been utilized for constructing a subtracted cDNA library, differential cloning and identifying differentially expressed genes in specific cell lines (3–6,8,9). The analysis of the transcripts isolated by using this technology can be most difficult, in that even a subtracted library invariably contains an abundance of common transcripts. We therefore used the polymerase chain reaction (PCR), Southern blot analysis and the Xenopus laevis oocyte expression system to ascertain the efficacy of the subtraction technique. Our goal was to utilize and expand the method as an alternative to traditional cloning techniques to facilitate the isolation of a growth-regulated renal sodium-dependent phosphate (NaPi) co-transporter, which we speculated was more abundant in the renal cortex of growing (3-week-old) than in adult (>12-week-old) animals. Due to the differences that exist in the renal handling of Pi between dietary Pi depletion and growth, we postulate that a transporter encoded by a growth-regulated mRNA different from NaPi-2, the transporter modulated during dietary Pi deprivation, accounts for the high rates of renal Pi transport observed during growth (7). Northern blot analysis performed in our laboratory had already confirmed that the expression of NaPi2 was greater in the renal cortex of adult than in growing animals (1). Our aim was therefore to eliminate the common NaPi-2 transcripts and ascertain the presence of a novel and up-regulated NaPi transcript in the renal cortex of growing rats. The protocol for subtractive hybridization used in our experiments was adapted from that of López-Fernández and Del Mozo (4). Hybridization was sought between cDNA derived from renal cortex of >12-week-old rats (the “driver” condition) and poly(A) RNA obtained from the renal cortex of 3week-old rats (the “tester” condition). Briefly, 10 μg poly(A) RNA from the renal cortex of >12-week-old rats were isolated on magnetic particles and used for first-strand cDNA synthesis. The cDNA generated binds to streptavidincoated magnetic particles (Promega, Madison, WI, USA). Poly(A) RNA (10 μg) isolated from the renal cortex of 3week-old rats was added to allow annealing of the mRNA to the cDNA for 20 min at 55°C. The subtracted poly(A) RNA after each passage was collected, and some aliquots were used for reverse transcription (RT)-PCR and Southern blotting, while aliquots after the third passage were injected into oocytes. RT-PCR (2) products for NaPi-2 (sense, position 1544–1565, CATGGCCAAGGCACTGGGCAAA) and (antisense, position 1944–1966, TAGAGCCGGGTGGCATTGTGGTG) (6) (423 bp) were abundant in the renal cortex of unsubtracted 3and 12-week-old rats (internal control) (Figure 1A). RT-PCR for β-actin (control) of the same samples resulted in abundant product in the unsubtracted samples and steady removal after two subtracted cycles (Figure 1B). Because residual NaPi-2-specific RT-PCR product might have escaped detection because of lack of sensitivity of ethidium bromide staining, we blotted the gels (Figure 1A) onto nylon membranes and carried out Southern hybridization using a [32P]dCTP-labeled full-length cDNA NaPi-2 probe. The results (Figure 2) confirm that poly(A) RNA, subjected to three cycles of subtractive hybridization, is completely depleted of NaPi-2 transcripts. With knowledge that NaPi-2 could be effectively removed by subtractive hybridization, we investigated whether a conserved region of another NaPi cotransporter was present within the renal cortex of 3-week-old animals. RT-PCR amplification products of unsubtracted 12and 3-week-old renal cortical poly(A) RNA and 3-week-old poly(A) RNA exposed to subtractive hybridization with 12-week-old renal cortical cDNA are shown in Figure 2. The primers used in these experiments were those specific for NaPi-2, and in addition, primers specific for a conserved region of all modulated (type II) NaPi
منابع مشابه
Identification of novel and known oocyte-specific genes using complementary DNA subtraction and microarray analysis in three different species.
The main objective of the present study was to identify novel oocyte-specific genes in three different species: bovine, mouse, and Xenopus laevis. To achieve this goal, two powerful technologies were combined: a polymerase chain reaction (PCR)-based cDNA subtraction, and cDNA microarrays. Three subtractive libraries consisting of 3456 clones were established and enriched for oocyte-specific tra...
متن کاملSelection of Genes Associated with Variations in the Circle of Willis in Gerbils Using Suppression Subtractive Hybridization
Deformities in the Circle of Willis (CoW) can significantly increase the risk of cerebrovascular disease in humans. However, the molecular mechanisms underlying these deformities have not been understood. Based on our previous studies, variations in the CoW of gerbils are hereditary. A normal CoW is observed in approximately 60% of gerbils, a percentage that also applies to humans. Thus, gerbil...
متن کاملAltered expression of Armet and Mrlp51 in the oocyte, preimplantation embryo, and brain of mice following oocyte in vitro maturation but postnatal brain development and cognitive function are normal.
Despite the efforts to recapitulate the follicle environment, oocytes from in vitro maturation (IVM) have poorer developmental potential than those matured in vivo and the effects on the resultant offspring are of concern. The aim of this study was to determine altered gene expression in oocytes following IVM and to evaluate the expression of the arginine rich, mutated in early stage of tumors ...
متن کاملDifferential gene expression analysis in fish exposed to endocrine disrupting compounds.
This review discusses various methodologies that can be used to understand, at the gene level, the consequences to fish upon exposure to endocrine disrupting compounds (EDCs). Several approaches for measuring expression of gene transcripts are discussed, including directed approaches, such as Northern blotting and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) as well as ...
متن کاملP-84: Phospholipase C Zeta: As an Index to Assess Fertilization Potential of a Semen Sample
Background: Failed fertilization post ICSI has been mainly attributed to the sperm’s inability to induce oocyte activation. Phospholipase C Zeta (PLCζ) is considered to be a primary factor for the induction of oocyte activation. The aim of this study was to quantitatively assess the expression of PLCζ in globozoospermic or individuals with previous low or failed fertilization in comparison to f...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- BioTechniques
دوره 21 6 شماره
صفحات -
تاریخ انتشار 1996