PCR, Southern blotting and oocyte expression to assess the efficacy of subtractive hybridization.

Subtractive hybridization is a technique designed to isolate genes and transcripts abundant in or unique to a particular condition. The method has been utilized for constructing a subtracted cDNA library, differential cloning and identifying differentially expressed genes in specific cell lines (3–6,8,9). The analysis of the transcripts isolated by using this technology can be most difficult, in that even a subtracted library invariably contains an abundance of common transcripts. We therefore used the polymerase chain reaction (PCR), Southern blot analysis and the Xenopus laevis oocyte expression system to ascertain the efficacy of the subtraction technique. Our goal was to utilize and expand the method as an alternative to traditional cloning techniques to facilitate the isolation of a growth-regulated renal sodium-dependent phosphate (NaPi) co-transporter, which we speculated was more abundant in the renal cortex of growing (3-week-old) than in adult (>12-week-old) animals. Due to the differences that exist in the renal handling of Pi between dietary Pi depletion and growth, we postulate that a transporter encoded by a growth-regulated mRNA different from NaPi-2, the transporter modulated during dietary Pi deprivation, accounts for the high rates of renal Pi transport observed during growth (7). Northern blot analysis performed in our laboratory had already confirmed that the expression of NaPi2 was greater in the renal cortex of adult than in growing animals (1). Our aim was therefore to eliminate the common NaPi-2 transcripts and ascertain the presence of a novel and up-regulated NaPi transcript in the renal cortex of growing rats. The protocol for subtractive hybridization used in our experiments was adapted from that of López-Fernández and Del Mozo (4). Hybridization was sought between cDNA derived from renal cortex of >12-week-old rats (the “driver” condition) and poly(A) RNA obtained from the renal cortex of 3week-old rats (the “tester” condition). Briefly, 10 μg poly(A) RNA from the renal cortex of >12-week-old rats were isolated on magnetic particles and used for first-strand cDNA synthesis. The cDNA generated binds to streptavidincoated magnetic particles (Promega, Madison, WI, USA). Poly(A) RNA (10 μg) isolated from the renal cortex of 3week-old rats was added to allow annealing of the mRNA to the cDNA for 20 min at 55°C. The subtracted poly(A) RNA after each passage was collected, and some aliquots were used for reverse transcription (RT)-PCR and Southern blotting, while aliquots after the third passage were injected into oocytes. RT-PCR (2) products for NaPi-2 (sense, position 1544–1565, CATGGCCAAGGCACTGGGCAAA) and (antisense, position 1944–1966, TAGAGCCGGGTGGCATTGTGGTG) (6) (423 bp) were abundant in the renal cortex of unsubtracted 3and 12-week-old rats (internal control) (Figure 1A). RT-PCR for β-actin (control) of the same samples resulted in abundant product in the unsubtracted samples and steady removal after two subtracted cycles (Figure 1B). Because residual NaPi-2-specific RT-PCR product might have escaped detection because of lack of sensitivity of ethidium bromide staining, we blotted the gels (Figure 1A) onto nylon membranes and carried out Southern hybridization using a [32P]dCTP-labeled full-length cDNA NaPi-2 probe. The results (Figure 2) confirm that poly(A) RNA, subjected to three cycles of subtractive hybridization, is completely depleted of NaPi-2 transcripts. With knowledge that NaPi-2 could be effectively removed by subtractive hybridization, we investigated whether a conserved region of another NaPi cotransporter was present within the renal cortex of 3-week-old animals. RT-PCR amplification products of unsubtracted 12and 3-week-old renal cortical poly(A) RNA and 3-week-old poly(A) RNA exposed to subtractive hybridization with 12-week-old renal cortical cDNA are shown in Figure 2. The primers used in these experiments were those specific for NaPi-2, and in addition, primers specific for a conserved region of all modulated (type II) NaPi